[MeltSim] help

[M. Dong]

Dear All,  
I have a short PCR seqence with two melting
     
peaks(AGACACAGTACTCGCAGTGCTTAATCGAAAAGGACAAGTACAGGAAGCAGATCCGCGAGCTGGAGGAGAAGAACGACGAGATGAGGATCGAGATGGTGC).
    But I am not sure it contains two different melting domains or not. So I
    want to know how to use meltsim to find the melting domains of the 
seqence.
    I would be very grateful if somebody help me solve this problem.
    thanks a lot!!!
    Best regards


    michelle