[MeltSim] help

[J.W. Bizzaro]

Hi Michelle,

Are you using the Windows or Unix/C version of MeltSim?  Both versions can produce "denaturation maps," which show the temperature at which each domain undergoes its transition.  The Windows version is particularly helpful in that it combines the derivative melting curve and denaturation map on screen so that you can see which curve is associated with which transition.  This is shown in the screenshot on the website:

  http://www.bioinformatics.org/meltsim/wiki/Main/MeltSimWin

Cheers,
Jeff


M. Dong wrote:
> Dear All,  I have a short PCR seqence with two melting
>     
> peaks(AGACACAGTACTCGCAGTGCTTAATCGAAAAGGACAAGTACAGGAAGCAGATCCGCGAGCTGGAGGAGAAGAACGACGAGATGAGGATCGAGATGGTGC). 
> 
>    But I am not sure it contains two different melting domains or not. So I
>    want to know how to use meltsim to find the melting domains of the 
> seqence.
>    I would be very grateful if somebody help me solve this problem.
>    thanks a lot!!!
>    Best regards
> 
> 
>    michelle


-- 
J.W. Bizzaro
Bioinformatics Organization, Inc. (Bioinformatics.Org)
E-mail: jeff at bioinformatics.org
Phone:  +1 978 562 4800
--