[MeltSim] help

[richard blake]

Jeff,
Thanks for sending this exchange. You have done an excellent job with  
the program and your window. Dick

On Feb 16, 2009, at 7:34 PM, J.W. Bizzaro wrote:

> Hi Michelle,
>
> Are you using the Windows or Unix/C version of MeltSim?  Both  
> versions can produce "denaturation maps," which show the  
> temperature at which each domain undergoes its transition.  The  
> Windows version is particularly helpful in that it combines the  
> derivative melting curve and denaturation map on screen so that you  
> can see which curve is associated with which transition.  This is  
> shown in the screenshot on the website:
>
>  http://www.bioinformatics.org/meltsim/wiki/Main/MeltSimWin
>
> Cheers,
> Jeff
>
>
> M. Dong wrote:
>> Dear All,  I have a short PCR seqence with two melting
>>     peaks 
>> (AGACACAGTACTCGCAGTGCTTAATCGAAAAGGACAAGTACAGGAAGCAGATCCGCGAGCTGGAGGAG 
>> AAGAACGACGAGATGAGGATCGAGATGGTGC).    But I am not sure it contains  
>> two different melting domains or not. So I
>>    want to know how to use meltsim to find the melting domains of  
>> the seqence.
>>    I would be very grateful if somebody help me solve this problem.
>>    thanks a lot!!!
>>    Best regards
>>    michelle
>
>
> -- 
> J.W. Bizzaro
> Bioinformatics Organization, Inc. (Bioinformatics.Org)
> E-mail: jeff at bioinformatics.org
> Phone:  +1 978 562 4800
> --
>
> _______________________________________________
> MeltSim maillist  -  MeltSim at bioinformatics.org
> http://www.bioinformatics.org/mailman/listinfo/meltsim