|
Automated design of mutagenic primers for site-directed mutagenesis
|
|
Home Primer Design:
DNA-basedProtein-based Primer Characterization Documentation Links ACTGCATGATGATCATGCGTCGTCGATGAT |
Primer Design Based on Protein Sequence Step 1. Upload a text file containing your template DNA sequence, or paste the sequence onto the text area below. You may enter a raw or Fasta-formatted sequence, starting in its proper reading frame. Click on "Translate". Home | Help |