Bioinformatics.Org Back to PrimerX homepage
Automated design of mutagenic primers for site-directed mutagenesis

Home

Primer Design:
    DNA-based
    Protein-based

Primer Characterization

Documentation

Links

ACTGCATGATGATCATGCGTCGTCGATGAT

Primer Design Based on Protein Sequence

Step 1. Upload a text file containing your template DNA sequence, or paste the sequence onto the text area below. You may enter a raw or Fasta-formatted sequence, starting in its proper reading frame. Click on "Translate".

1        10        20        30        40        50        60
|........|.........|.........|.........|.........|.........|

Your sequence length should be between 40 and 8,000 bp. Make sure that the target site for mutation is flanked on each side by a sufficient length of DNA. All non-GCAT characters in the sequence will automatically be removed.

 


Home | Help