Format Conversion
-Combine FASTA
-EMBL to FASTA
-EMBL Feature Extractor
-EMBL Trans Extractor
-Filter DNA
-Filter Protein
-GenBank to FASTA
-GenBank Feature Extractor
-GenBank Trans Extractor
-One to Three
-Range Extractor DNA
-Range Extractor Protein
-Reverse Complement
-Split Codons
-Split FASTA
-Three to One
Sequence Analysis
-Codon Plot
-Codon Usage
-CpG Islands
-DNA Molecular Weight
-DNA Pattern Find
-DNA Stats
-Fuzzy Search DNA
-Fuzzy Search Protein
-Ident and Sim
-Multi Rev Trans
-Mutate for Digest
-ORF Finder
-Pairwise Align Codons
-Pairwise Align DNA
-Pairwise Align Protein
-PCR Primer Stats
-PCR Products
-Protein GRAVY
-Protein Isoelectric Point
-Protein Molecular Weight
-Protein Pattern Find
-Protein Stats
-Restriction Digest
-Restriction Summary
-Reverse Translate
-Translate
Sequence Figures
-Color Align Conservation
-Color Align Properties
-Group DNA
-Group Protein
-Primer Map
-Restriction Map
-Translation Map
Random Sequences
-Mutate DNA
-Mutate Protein
-Random Coding DNA
-Random DNA Sequence
-Random DNA Regions
-Random Protein Sequence
-Random Protein Regions
-Sample DNA
-Sample Protein
-Shuffle DNA
-Shuffle Protein
Miscellaneous
-IUPAC codes
-Genetic codes
-Browser compatibility
-Mirror this site
-Use this site off-line
-About this site
-Acknowledgments
-Reference
The Sequence Manipulation Suite Copyright © 2000, 2004 Paul Stothard. Send questions and comments to stothard@ualberta.ca
home
Sequence Manipulation Suite:
Translate
Translate accepts a DNA sequence and converts it into a protein in the reading frame you specify. Translate supports the entire IUPAC alphabet and several genetic codes.
Paste a raw sequence or one or more FASTA sequences into the text area below. Input limit is 200000 characters.
>sample sequence gckugcgaygartty >sample sequence 2 ggwgggggaggtggcgaggaagatgacgtggtagttgtcgcggcagctgccaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatcacctgctacttctcccgccacctccc
Please check the
browser compatibility
page before using this program.
Translate in
reading frame 1
reading frame 2
reading frame 3
uppercase frame
on the
direct
reverse
strand.
Use the
standard (1)
vertebrate mitochondrial (2)
yeast mitochondrial (3)
mold mitochondrial (4)
invertebrate mitochondrial (5)
ciliate nuclear (6)
echinoderm mitochondrial (9)
euplotid nuclear (10)
bacterial (11)
alternative yeast nuclear (12)
ascidian mitochondrial (13)
flatworm mitochondrial (14)
Blepharisma macronuclear (15)
chlorophycean mitochondrial (16)
trematode mitochondrial (21)
Scenedesmus obliquus mitochondrial (22)
Thraustochytrium mitochondrial (23)
genetic code
.
*This page requires JavaScript. See
browser compatibility.
*You can
mirror this page
or
use it off-line
.
new window
|
home
|
citation
2.4.4-Fri Jul 4 18:31:30 2008