Home | New RFLP Analysis | Help
  1. What is DistinctiEnz
  2. Input Sequence
  3. Sequence Options
  4. Enzyme Selection
  5. Output and Analysis Options
  6. Analysis Output

 

 

 

 


^^ What is DistinctiEnz

DistinctiEnz is a web tool for performing a virtual RFLP with a set of restriction enzymes on a set of DNA sequences. The name DistinctiEnz comes from DISTINCTION. The tool was produced by Mohammadreza Rezailashkajani and Delnaz Roshandel, Department of Bioinformatics, Research Center for Gastroenterology and Liver Diseases, Shaheed Beheshti University of Medical Sciences. We wish to express our gratitude to Caroline Reiff who first suggested the idea of producing such a tool when we were all taking the Biocomputing module in University of Manchester.
DistinctiEnz is used to get an estimate of DISTINCTION power of a set of enzymes for a set of sequences. In other words, it helps the user to learn with what enzyme or set of enzymes, he or she can best DISTINGUISH between a set of sequences using RFLP.
DistinctiEnz performs a restriction analysis on each sequence and examines all fragments to see how unique the cut fragments from each sequence are when compared to all other fragment sets produced from other sequences in the uploaded set of sequences. Finally a Resolution Power (Ratio) is calculated by simply dividing the number of unique-fragment sets by the number of the submitted sequences. If Resolution power is 100%, it means that that set of enzymes can fully perform a DISTINCTION analysis among the submitted sequences. However if only ONE pattern is produced by all sequences, the resolution power will be set to 0 (e.g. it is not calculated from the formula above). Unique fragment sets are detected first by calculating the number of fragments each sequence produces. If this is unique for each sequence then the resolution is 100%. If either pair of the sequences produce equal number of fragments then uniqueness is defined by finding at least one fragment of the 2 sequences having a different size.
Notice: For very long sequences, if fragments over 100,000 base pairs are produced then the Resolution Power may be falsely high because over 100,000 (having a log value near 4) sequences may produce zero or negative migration distances (see below). In other words, the application calculates differences while in RFLP Gel we get lower resolution.

Resolution power = number of unique-fragment sets / number of the submitted sequences


The program allows the user to:

  1. Upload a set of sequences in FASTA format all in ONE FASTA file
  2. Choose one or more restriction enzymes out of a list of more than 500 type II restriction enzymes
  3. Choose a dilation factor for the RFLP Gel. The more this factor the better the sequences are separated on the gel though it is not the rule with too long sequences.
  4. Perform an RFLP and get a Resolution Power value in addition to graphic RFLP Gel view.

Alternatively, DistinctiEnz can be used with uploading a file with one sequence just to simply see the virtual RFLP Gel view of any sequence.

 


^^ Input Sequence

Use the Browse button to upload a file containing ALL your sequences in FASTA format.

Browse to upload a FASTA file containing ALL your sequences in FASTA format.

An example of the content of such file can be the following having been saved in text format with .FASTA extension.

>Sequence_a
CACACATTTAGGATTTTTATTCCGCTCCGGAATTCCCCGGCCCATATGAGCGCT
TATACTTTTTTTTTTTCCGCGCGCTACGTAAGCGCTTCGCCCAGC
TTTTTATTCCTTTATTATAAACCGGAACCTCCGGCAGGAAA

>Sequence_b
TTCCACACATTTAGGAATTCCGCTCCGGAATTCCCCGGCCCATATGAGCGCTTATACGCGAATTCGAGCGCTTC
CGCGCGCTACGTAAGCGCTTCGCCCAGCGGAATTCCTTTATTATAAACCGGAACCTCCGGCAGGAAATTTTTTTTTT
TTTTTTTTTTTTATACGCGAATTCTTTTTTTTTGAGCGCTTCCGCGCGCTACGTAAGCGCTTCGCCCAGCGGAATTCCTTTAT
TATAAACCGGAACCTCCGGCAGGAA

>Sequence_c
TTTTTTTCCCTTTTTTTTATTCCGCTCCGGAATTCCCCGGCCCATATGAGCGCT
TATACGCGAATTCGAGCGCTTCCGCGCGCTACGTAAGCGCTTCGCCCAGC GGAATTCCTTTATTATAAACCGGAACCTCCGG
CAGGAAA

Click here to download the above sequences in one FASTA file in Zip format. Please unzip them and test in DistinctiEnz with EcoNI and EcoRI and a dilation factor of 30.


^^ Sequence Options

If ALL of your sequences are circular please check the corresponding box shown below. If linear sequences are submitted, leave this box unchecked. It is not possible to submit circular and linear sequences simultaneously in one file. All sequences must be either circular OR linear. If unchecked, ALL the sequences in the uploaded file will be considered linear.
If your sequence contains non-atcg characters such as numbers, tabs, etc; check the Turn on PowerCleaner! box which will remove all characters but a, t, c, and g.

All uploaded sequences are circular.
Turn on PowerCleaner! (Cleans all non-atcg characters from the above-pasted/uploaded sequence.)





^^ Enzyme Selection

You can select one or more restriction enzymes to perform a multiple digest. Control+ click to select more than one enzyme.
For example, the sequence shown in the table above can be cut by EcoNI and EcoRI enzymes. You can have a test yourself with either or both enzymes simultaneously. Click here to download the above sequences in one FASTA file in Zip format. Please unzip before testing and cut the sequences by EcoNI and EcoRI. Especially test this sequence with and without checking "Sequences are Circular" checkbox explained above.

Select one or more enzymes (Ctrl+click):

 




^^ Output and Analysis Options

When you choose Test each enzyme option, a single digest is performed for each selected enzyme and Resolution Profile is outputted for each; there will be no graphical output. If this option is NOT selected, then a multiple-digest with all selected enzyme occurs and a graphical RFLP output is produced.

Test each enzyme (May take a long time).

The graphical RFLP Gel output is produced by calculating the migration distances of DNA fragments using the formula below (Source: Molecular Cloning, a Laboratory Manual. Sambrook, Fritsch, Maniatis. CSHL Press, 1989.)

distance = dilation * (4 - log10length(dna))


As stated in documentation of [Bio::Tools::Gel] module of Bioperl (http://bioperl.org), "the formula calculates migration distances based solely on the length of the nucleotide sequence. Secondary or tertiary structure, curvature, and other biophysical attributes of a sequence are currently not considered."
 Since the formula above generates negative values when log10(length(dna) is more than 4, as a correction for the sequences meeting this condition, no migration will occur (instead of negative migration).
Based on the statements above, you can set the dilation factor. The more the dilation factor, the better the bands are separated. However, these figures and formula give a rough measure. In fact, the distinguishability of 2 RFLP bands vary with sequence length with shorter DNA fragments separated better than longer ones.

Select RFLP gel dilation factor:

RFLP graphical output contains test markers called LADDERS. These are used to mark bands sequence fragments of known sizes to easily guess the size of other bands.

Select a ladder for RFLP.

Finally press the button .


^^ Analysis Output

The analysis gives a Resolution Profile and a graphical RFLP Gel output. In fact, the application automatically adds a sq_n_ prefix to your sequence names which will make sequences appear as they were ordered in the originally uploaded FASTA file.
Therefore the sequence names will look like: sq_1_The name of 1st seq, sq_2_The name of 2nd seq, etc. You will see the band columns for each sequence having a label of sequence name as described above at top of the column.
Resolution Profile calculation method is explained in What is DistinctiEnz section.
Images are produced in png format which is supported by most browsers. Below is a png image of the analysis of the sequences file described above cut EcoNI and EcoRI.
You can move your mouse on the picture to get length of fragment sizes in base pairs. However, for longer fragments the figure shown on mouse move may not be exact.

 

 

 

 

 

 

 

 

^^