^^ Input Sequence

You can paste your sequence as shown below:

Or use the Browse button to upload a sequence file in FASTA format.

Or alternatively browse to upload a sequence file in FASTA format (the sequence pasted above will be neglected).

If you browse to a sequence file the pasted sequence will be neglected and the file is preferred.

^^ Sequence Options

If your sequence is circular please check the corresponding box shown below. If a linear sequence is submitted, leave this box unchecked.
If your sequence contains non-atcg characters such as numbers, tabs, etc; check the Turn on PowerCleaner! box which will remove all characters but a, t, c, and g.

Sequence is circular. Turn on PowerCleaner! (Cleans all non-atcg characters from the above-pasted/uploaded sequence.)

^^ Enzyme Selection

You can select one or more restriction enzymes to perform a multiple digest. Control+ click to select more than one enzyme.
For example, the sequence shown in the text-area above can be cut by EcoNI and EcoRI enzymes. You can have a test yourself with either or both enzymes simultaneously. Specially test this sequence with and without checking Sequence is Circular box explained above. Download the test sequence here in Zip format and cut it with EcoNI and EcoRI.

Select one or more enzymes (Ctrl+click): EcoHI EcoICRI EcoNI EcoO109I EcoO65I EcoRI EcoRII EcoRV EcoT14I EcoT22I EcoT38I EgeI EheI ErhI EsaBC3I EspI

^^ View Options

You can select the desired output by checking/unchecking the view option boxes. For example unchecking the Show Sequence view will produce a more printer-friendly output.

Finally, click the button to start analysis.

View options let you choose the type of output you wish. You can uncheck unwanted views to get a more printer-friendly output. Both Lengths view and Map view are printer-friendly.

^^ Analysis Output

Analysis output includes a summary including the number of cuts, overhang type, and cut site sequence by selected enzymes. Overhang says what kind of overhang each enzyme cut produces and may be 5', 3' or blunt. In addition 3 view outputs are produced and below is an illustrated summary of the view outputs for the sequence shown above cut by EcoNI and EcoRI.
Lengths view simply provides a visual overview of the lengths produced in the digest. This view is adjusted to 400 pixel width in each analysis. The lengths shown This helps you get a notion of the relative lengths of the fragments produced especially when fragments are too long.

No	Size (bps)
1->	8
2->	13
3->	15
4->	28
5->	28
6->	32
7->	38
8->	44
9->	53

Sequence view enables you to select each fragment sequence by simply double clicking on it and copying it in your browser (Right click on the selected sequence and choose copy). However, this view is not printer-friendly if fragments are too long.

No	Length	Fragment sequence (To copy a sequence, double click to select.)
1	8	GGCAGGAA
2	13	AATTCCGCTCCGG
3	15	TTCCACACATTTAGG
4	28	AATTCCTTTATTATAAACCGGAACCTCC
5	28	AATTCCTTTATTATAAACCGGAACCTCC
6	32	AATTCCCCGGCCCATATGAGCGCTTATACGCG
7	38	GGCAGGAAATTTTTTTTTTTTTTTTTTTTTTATACGCG
8	44	AATTCGAGCGCTTCCGCGCGCTACGTAAGCGCTTCGCCCAGCGG
9	53	AATTCTTTTTTTTTGAGCGCTTCCGCGCGCTACGTAAGCGCTTCGCCCAGCGG

Map view helps you get a virtual image of cut positions and enzyme names of the corresponding cuts. The superscript numbers show the base at 5' side of cut position. The map wraps for better fitting the page width for print views, however, you can click "Make map No Wrap" link below the map when the map rows have wrapped in two lines and you wish them appear straight on one line.

If the map rows has wrapped click here: Make map No Wrap

^^