|
|
Main.ImperfectRepeats History
Hide minor edits - Show changes to markup
November 08, 2006, at 10:13 PM
by Angie -
Changed lines 5-7 from:
most programs compute imperfect repeat under 1)the Hamming distance model (only substitutions), others apply 2) the Edit distance model (substitutions, instertions, deletions)
to:
most programs compute imperfect repeat under 1) the Hamming distance model (only substitutions), others apply 2) the Edit distance model (substitutions, instertions, deletions)
November 08, 2006, at 10:12 PM
by Angie -
Changed lines 3-4 from:
= microsatellites containing mutations (substitution, insertion, deletions)\\
to:
= microsatellites containing mutations (substitution, insertion, deletions)
Changed lines 14-17 from:
- as minimum or average alignment score of two neighbouring copies over the entire array
- as minimum or average alignment score of two random copies within the array
to:
- as average alignment score of two neighbouring copies over the entire array
- as average alignment score of two random copies within the array
November 08, 2006, at 10:10 PM
by Angie -
Changed lines 8-10 from:
'''
similarity (or number of mutations) can be measured in several ways:'''
to:
similarity (or number of mutations) can be measured in several ways:
November 08, 2006, at 10:09 PM
by Angie -
Changed lines 8-10 from:
similarity (or number of mutations) can be measured in several ways:
to:
'''
similarity (or number of mutations) can be measured in several ways:'''
Changed line 17 from:
to:
November 08, 2006, at 10:07 PM
by Angie -
Added lines 1-21:
Imperfect repeats
= microsatellites containing mutations (substitution, insertion, deletions)
most programs compute imperfect repeat under 1)the Hamming distance model (only substitutions), others apply 2) the Edit distance model (substitutions, instertions, deletions)
e.g. 1) ACACACATACA or, 2) ATGCATGCTATGCATGCATGC
similarity (or number of mutations) can be measured in several ways:
- every n-th nucleotide is a mismatch
- as average alignment score of all copies to a computed consensus sequence
- as minimum or average alignment score of two neighbouring copies over the entire array
- as minimum or average alignment score of two random copies within the array
programs
- search strategy: heuristic?!, modelling, autocorrelation
- filter: statistical criteria, E-value, p-value, biological significance
|
|