Login
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all programing and coding was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
Software Limitation:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format *
like:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA
Website hosting:
The website hosting is done by
Bioinformatics Organization
which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness e.g., a program is distributed under an OSI-approved license.
*
Fasta and other formats not accepted.