|
|
Main.AboutThisSite History
Hide minor edits - Show changes to markup
July 27, 2010, at 02:45 PM
by 82.39.32.150 -
Changed lines 26-27 from:
which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness e.g., a program is distributed under an OSI-approved license. http://opensource.org/licenses/
to:
which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness e.g., a program is distributed under an OSI-approved license.
July 27, 2010, at 02:44 PM
by 82.39.32.150 -
Changed lines 24-25 from:
The website hosting is done by Bioinformatics Organization
http://www.bioinformatics.org/wiki/Bioinformatics_Organization
to:
The website hosting is done by
Bioinformatics Organization
July 26, 2010, at 06:41 PM
by 82.39.32.150 -
Changed lines 28-29 from:
*''
Fasta and other formats not accepted.''
to:
*
Fasta and other formats not accepted.
July 26, 2010, at 06:40 PM
by 82.39.32.150 -
Changed lines 28-29 from:
*Fasta and other formats not accepted.
to:
*''
Fasta and other formats not accepted.''
July 26, 2010, at 06:40 PM
by 82.39.32.150 -
Changed lines 11-13 from:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only ''Plain sequence format"
* like:
to:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format *
like:
July 26, 2010, at 06:39 PM
by 82.39.32.150 -
Changed lines 11-13 from:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only ''Plain sequence format
*'' like:
to:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only ''Plain sequence format"
* like:
July 26, 2010, at 06:38 PM
by 82.39.32.150 -
Changed lines 11-12 from:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format * like:
to:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only ''Plain sequence format
*'' like:
July 26, 2010, at 06:38 PM
by 82.39.32.150 -
Changed lines 11-12 from:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format * like:
to:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format * like:
July 26, 2010, at 06:37 PM
by 82.39.32.150 -
Changed lines 11-12 from:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only %red& Plain sequence format * like:
to:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format * like:
July 26, 2010, at 06:37 PM
by 82.39.32.150 -
Changed lines 11-12 from:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format * like:
to:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only %red& Plain sequence format * like:
July 26, 2010, at 06:35 PM
by 82.39.32.150 -
Changed lines 11-12 from:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format X like:
to:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format * like:
Changed line 27 from:
X- Fasta and other formats not accepted.
to:
*Fasta and other formats not accepted.
July 26, 2010, at 06:34 PM
by 82.39.32.150 -
Changed lines 11-13 from:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output.
to:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output. So, it is recommended to use only Plain sequence format X like:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA
Added line 27:
X- Fasta and other formats not accepted.
July 21, 2010, at 11:40 AM
by 82.39.32.150 -
Changed line 7 from:
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
to:
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all programing and coding was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
July 21, 2010, at 11:37 AM
by 82.39.32.150 -
Changed line 7 from:
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
to:
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
July 21, 2010, at 11:36 AM
by 82.39.32.150 -
Changed lines 7-8 from:
GAUTAM ORF FINDER
is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
to:
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
July 21, 2010, at 11:36 AM
by 82.39.32.150 -
Changed lines 6-8 from:
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
to:
GAUTAM ORF FINDER
is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
July 21, 2010, at 11:35 AM
by 82.39.32.150 -
Changed lines 17-18 from:
which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/
to:
which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness e.g., a program is distributed under an OSI-approved license. http://opensource.org/licenses/
July 21, 2010, at 11:34 AM
by 82.39.32.150 -
Changed line 15 from:
to:
The website hosting is done by Bioinformatics Organization
July 21, 2010, at 11:28 AM
by 82.39.32.150 -
Changed line 15 from:
The website hosting is done by Bioinformatics Organization
to:
July 21, 2010, at 11:27 AM
by 82.39.32.150 -
Changed lines 16-17 from:
http://www.bioinformatics.org/wiki/Bioinformatics_Organization which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/
to:
http://www.bioinformatics.org/wiki/Bioinformatics_Organization
which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/
July 21, 2010, at 11:26 AM
by 82.39.32.150 -
Changed lines 16-17 from:
Bioinformatics_Organization? which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
to:
http://www.bioinformatics.org/wiki/Bioinformatics_Organization which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/
July 21, 2010, at 11:25 AM
by 82.39.32.150 -
Changed lines 16-17 from:
Bioinformatics_Organization> which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
to:
Bioinformatics_Organization? which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
July 21, 2010, at 11:23 AM
by 82.39.32.150 -
Changed lines 15-17 from:
The website hosting is done by Bioinformatics Organization
Bioinformatics_Organization> which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
to:
The website hosting is done by Bioinformatics Organization
Bioinformatics_Organization> which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
July 21, 2010, at 11:22 AM
by 82.39.32.150 -
Changed lines 16-17 from:
Bioinformatics_Organization> which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
to:
Bioinformatics_Organization> which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
July 21, 2010, at 11:20 AM
by 82.39.32.150 -
Changed lines 15-16 from:
The website hosting is done by Bioinformatics Organization http://www.bioinformatics.org/wiki/Bioinformatics_Organization which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
to:
The website hosting is done by Bioinformatics Organization
Bioinformatics_Organization> which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
July 21, 2010, at 11:19 AM
by 82.39.32.150 -
Changed lines 12-15 from:
Website hosting:
The website hosting is done by Bioinformatics Organization which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
to:
Website hosting:
The website hosting is done by Bioinformatics Organization http://www.bioinformatics.org/wiki/Bioinformatics_Organization which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
July 21, 2010, at 11:14 AM
by 82.39.32.150 -
Changed lines 12-13 from:
to:
Website hosting:
The website hosting is done by Bioinformatics Organization which is an international organization that promotes open-access in the field of bioinformatics by providing free and open resources for research, development and education so that such resources can be further developed. The Organization has a Web-based collaborative development environment (CDE) for bioinformatics projects that are developed in the spirit of freedom and openness (e.g., a program is distributed under an OSI-approved license http://opensource.org/licenses/).
July 21, 2010, at 11:08 AM
by 82.39.32.150 -
Changed line 6 from:
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
to:
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
Changed lines 8-9 from:
Software Limitation:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output.
to:
Software Limitation:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output.
Website hosting:
July 21, 2010, at 11:06 AM
by 82.39.32.150 -
Changed lines 1-3 from:
This is a default page.if ! auth edit
to:
July 21, 2010, at 11:05 AM
by 82.39.32.150 -
Changed lines 4-9 from:
to:
Login(:ifend:)
GAUTAM ORF FINDER is a bioinformatics tool developed in 2008 to find Orf present in any DNA sequence. Methodology adopted for completion of the project was empirical and analytical. As biology has increasingly turned into a data-rich science, the need for storing and communicating large data sets has grown tremendously. We know that there are various bioinformatics tools present across web to find ORF. But they are not so user friendly. As it is not easy for everyone to handle these bioinformatics tools. So, keeping all these things in consideration this tool was developed in which all the work was prior done by me and no such technical knowledge is required to handle the tool. The user has to simply input the DNA sequence and can easily get desired output within seconds.
Software Limitation:
Result may be erroneous if user had input wrong DNA sequence i.e. instead of using ATGC other characters are used then program will run but user will not get desired output.
|
|