Bioinformatics.org
[Regeneron]
[Repositive.io]
[OMICtools]
Not logged in
  • Log in
  • Bioinformatics.org
    Membership (39409+) Group hosting [?] Wiki
    Franklin Award
    Sponsorships

    Careers
    About bioinformatics
    Bioinformatics training
    Bioinformatics jobs

    Research
    All information groups
    Online databases Online analysis tools Online education tools More tools

    Development
    All software groups
    FTP repository
    SVN & CVS repositories [?]
    Mailing lists

    Forums
    News & Commentary
  • Submit
  • Archives
  • Subscribe

  • Jobs Forum
    (Career Center)
  • Submit
  • Archives
  • Subscribe
  • BIRCH: Comprehensive bioinfo. system - Support tickets

    Submit | Open tickets | Closed tickets

    [ Ticket #1208 ] saving short sequences from sequence canvas
    Date:
    01/13/16 18:21
    Submitted by:
    B_Fristensky
    Assigned to:
    B_Fristensky
    Category:
    bioLegato
    Priority:
    4
    Ticket group:
    Bug
    Resolution:
    Not Resolved
    Summary:
    saving short sequences from sequence canvas
    Original submission:
    When a block of sequences is selected in the sequence canvas, and one or more sequences is shorter than the
    selected region, an error is generated.

    Example:

    gggggtttttcccccaaaaa
    gggggtttttcc
    gggggtttttcccccaaaaa

    If the selection spanned columns 1 - 12, the sequences are exported. If a selection is made longer than 12 ie. the length of the shortest sequence, an error is generated:

    Exception in thread "Thread-16" java.lang.StringIndexOutOfBoundsException: String index out of range: 177
    at java.lang.AbstractStringBuilder.substring(AbstractStringBuilder.java:870)
    at java.lang.StringBuffer.subSequence(StringBuffer.java:404)
    at java.io.Writer.append(Writer.java:269)
    at java.io.Writer.append(Writer.java:50)
    at org.biolegato.sequence.data.GDEFlatfile.translateTo(GDEFlatfile.java:58)
    at org.biolegato.sequence.data.DataFormat.translateTo(DataFormat.java:129)
    at org.biolegato.sequence.canvas.SequenceTextArea.writeOut(SequenceTextArea.java:1890)
    at org.biolegato.sequence.canvas.SequenceCanvas.writeFile(SequenceCanvas.java:1327)
    at org.biolegato.sequence.canvas.SequenceCanvas.writeFile(SequenceCanvas.java:1293)
    at org.biopcd.widgets.TempFile.getInstance(TempFile.java:186)
    at org.biopcd.parser.CommandThread.run(CommandThread.java:202)
    at java.lang.Thread.run(Thread.java:745)

    Interestingly, this appears to happen in Java 1.7.0_91, but not Java 1.8. Nonetheless, it should be fixed.
    Please log in to add comments and receive followups via email.
    No followups have been posted
    No results for "Dependent on ticket"
    No results for "Dependent on Task"
    No other tickets are dependent on this ticket
    Ticket change history
    Field Old value Date By
    status_id Pending 01/13/16 18:22 B_Fristensky
    priority 5 01/13/16 18:22 B_Fristensky
    assigned_to unset 01/13/16 18:22 B_Fristensky
    resolution_id Unset 01/13/16 18:22 B_Fristensky

     

    [G6GFindr]
    Copyright © 2017 · Scilico, LLC