Bioinformatics.org
[University of Birmingham]
[Patsnap]
Not logged in
  • Log in
  • Bioinformatics.org
    Membership (44436+) Group hosting [?] Wiki
    Franklin Award
    Sponsorships

    Careers
    About bioinformatics
    Bioinformatics jobs

    Research
    All information groups
    Online databases Online analysis tools Online education tools More tools

    Development
    All software groups
    FTP repository
    SVN & CVS repositories [?]
    Mailing lists

    Forums
    News & Commentary
  • Submit
  • Archives
  • Subscribe

  • Jobs Forum
    (Career Center)
  • Submit
  • Archives
  • Subscribe
  • Career Center - Message forums

    Opportunity: Apply your computing skills to DNA at MIT, Broad Institute--Cambridge, MA (US)
    Submitted by Broad HR; posted on Wednesday, September 26, 2007

    Apply your computing skills to DNA at MIT!

    Have stellar computational skills, PhD or equivalent experience? Enjoy solving nearly impossible problems? We’ll retrain you to work with cutting-edge DNA technology!

    We find biomedical applications for new DNA sequencing instruments yielding billions of short DNA sequences like

    AATGTAATTTCAAATGTTAGCTCATTTTTGTTAATG

    We need you on our team to solve the hard mathematical and computational challenges using terabytes of these data. We invent algorithms, delve deeply in the data, code like crazy, help design laboratory experiments: we do whatever is needed to make the new technologies fulfill their promise to unlock the mysteries of genomics and biomedical research in critical areas like cancer, human genetics, infectious disease, antibiotic discovery, genome evolution, man’s inhumanity to man, and the number 42.

    We seek candidates from highly diverse backgrounds, industrial and academic. Mathematical and computational experience and excellence required, including superb C++ skills in a Linux or Unix environment. Biology training helpful but not required as you can learn on the job. Outstanding oral and written communication skills, joy in teamwork. A group leader position is also open for a candidate with proven leadership experience in computational science.

    The Broad Institute of MIT and Harvard has an intense, exciting environment, world-class laboratory and computing facilities, hundreds of scientists tackling a wide range of critical problems in biology and medicine. Come join us!

    HOW TO APPLY

    Apply now at http://hrweb.mit.edu/staffing/, search for mit-00003916 and mit-00004577, Computational Biologist and Group Leader positions. We are an equal opportunity, affirmative action employer.

    Expanded view | Monitor forum | Save place

    Start a new thread:
    You have to be logged in to post a reply.

     

    Copyright © 2024 Scilico, LLC · Privacy Policy