-
The Sequence Manipulation Suite is a collection of web-based programs for analyzing and formatting DNA and protein sequences....The output of each program is a set of HTML commands, which is rendered by your web browser as a standard web page. You can print and save the results, and you can edit them using an HTML editor or a text editor."
http://www.ualberta.ca/~stothard/javascript/index.html
Reference by Gary Van Domselaar. The tools were written by Paul Stothard of the University of Alberta.
Discussion forums: URL: 36 Sequence Manipulation Tools...in Javascript!
Expanded view | Monitor forum | Save place
Comment
reverse sequence tool
Submitted by
Nobody
;
posted on
Sunday, June 8, 2003
|
GGGAATTCGATTGTTGCCCCGGGGCTCCTCGCATGTAACTTTGCCACCCTCCCATACCGACTGTATGTGGGTATCCCCTCCTACCCCGCCTTGGGAGCCCCATGTGAGGTAGCCAGCCCTTTCCCTGGCCCTGGGCCCTCCATTTCTGCTTGCTGTCTCCTCTGTTCCTCCCAAGAACTCACTGCTCTACCGTGTAACCTCTTGTTTCTCTGCTGTCTTAGTCCGCTTGGGCTGCCGGGAGGAGCACACCTTAGGCAGGGAGGCTTAGATGCACCTGTGCATGGTTCTGGAGGCCAGGAGCCCCGGGGCAACAATCACTAGTGAATTCGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTANNTAGCTTGGCGT
|
Reply to this comment:
You have to be logged in to post a reply.