-
Control Systems and Computer Society - 6:00PM, 12 September
``This talk will be the first in a monthly series of meetings on bioinformatics to be jointly sponsored by the IEEE Control Systems Society, the IEEE Computer Society and the Greater Boston Chapter of the ACM. This introductory talk will outline tentative answers to the above questions as it briefly surveys some critical problems and techniques in the field. Emphasis will be placed on fundamental biological grounding rather than detailed algorithmic techniques, which will be addressed in future talks in this series.''URL
http://www.ieee-boston.org/control_systems.htm
Reference by Allan Kleinman.
Discussion forums: Conference: Bioinformatics and Genomics-Based Drug Discovery
Expanded view | Monitor forum | Save place
Comment
dna second structure
Submitted by
Nobody
;
posted on
Thursday, September 27, 2001
|
aaccttg ggtacgtcagt cgataacgt cgattgacacgattgacagtcagtcgatc
|
Reply to this comment:
You have to be logged in to post a reply.
Thread view:
|
